Keyboard shortcuts

Press or to navigate between chapters

Press S or / to search in the book

Press ? to show this help

Press Esc to hide this help

Control Flow

BioLang provides a rich set of control-flow constructs designed for the messy realities of biological data. Variants need classification, samples need multi-criteria gating, and searches over sequences must handle both the found and not-found cases gracefully.

if/else Expressions

if/else in BioLang is an expression – it returns a value. This lets you embed conditional logic directly in assignments and pipes.

let label = if gc_content(seq) > 0.6 {
    "GC-rich"
} else if gc_content(seq) < 0.4 {
    "AT-rich"
} else {
    "balanced"
}

Because it is an expression, you can use it inline:

let allele_freq = if total_depth > 0 { alt_count / total_depth } else { 0.0 }

match Expressions

match compares a value against a series of patterns. Like if, it is an expression and returns the result of the matching arm.

let codon = "ATG"

let amino_acid = match codon {
    "ATG" => "Met"
    "TGG" => "Trp"
    "TAA" | "TAG" | "TGA" => "Stop"
    _ => codon_usage(codon)
}

Patterns can destructure records:

fn describe_alignment(aln) {
    match aln {
        {mapped: true, mapq: q} if q >= 30 => "high-confidence"
        {mapped: true, mapq: q} if q >= 10 => "low-confidence"
        {mapped: true}                     => "very-low-quality"
        {mapped: false}                    => "unmapped"
    }
}

for Loops

The basic for loop iterates over any collection or stream.

let reads = read_fastq("data/reads.fastq")
let total_bases = 0

for read in reads {
    total_bases = total_bases + len(read.seq)
}

print("Total bases: " + str(total_bases))

Tuple Destructuring

When iterating over paired data, destructure directly in the loop header.

let sample_ids = ["S1", "S2", "S3"]
let fastq_paths = [
    "data/S1_R1.fastq.gz",
    "data/S2_R1.fastq.gz",
    "data/S3_R1.fastq.gz"
]

for (sample, path) in zip(sample_ids, fastq_paths) {
    let stats = read_fastq(path) |> read_stats()
    print(sample + ": " + str(stats.total_reads) + " reads")
}

Destructuring also works with enumerate:

let exons = read_bed("data/exons.bed")

for (i, exon) in enumerate(exons) {
    print("Exon " + str(i + 1) + ": " + exon.chrom + ":" + str(exon.start) + "-" + str(exon.end))
}

for/else

The else block executes only when the loop completes without hitting a break. This is perfect for search-and-report patterns.

# requires: internet connection
let target = dna"TATAAA"
let promoters = read_bed("data/regions.bed")

for region in promoters {
    let seq = ucsc_sequence("hg38", region.chrom, region.start, region.end)
    if contains(seq, target) {
        print("TATA box found in " + region.name)
        break
    }
} else {
    print("No TATA box found in any promoter region")
}

while Loops

Use while when the number of iterations is unknown ahead of time.

fn find_orfs_manual(seq) {
    let i = 0
    let in_orf = false
    let orf_start = 0
    let orfs = []

    while i + 2 < len(seq) {
        let codon = slice(seq, i, i + 3)
        if codon == "ATG" && !in_orf {
            in_orf = true
            orf_start = i
        }
        if (codon == "TAA" || codon == "TAG" || codon == "TGA") && in_orf {
            orfs = orfs + [{start: orf_start, end: i + 3, length: i + 3 - orf_start}]
            in_orf = false
        }
        i = i + 3
    }
    orfs
}

let orfs = find_orfs_manual("ATGAAACCCTAGATGTTTGAATAA")
# [{start: 0, end: 12, length: 12}, {start: 12, end: 24, length: 12}]

break and continue

break exits the innermost loop. continue skips to the next iteration.

let variants = read_vcf("data/variants.vcf")
let first_pathogenic = nil

for v in variants {
    # Skip low-quality calls
    if v.qual < 30.0 {
        continue
    }

    let info = parse_info(v.info_str)
    if info?.CLNSIG == "Pathogenic" {
        first_pathogenic = v
        break
    }
}

given/otherwise

given/otherwise is a declarative chain of conditions. It reads top to bottom; the first true condition wins. otherwise is the fallback.

fn classify_read_pair(r1_len, r2_len, insert_size) {
    given {
        insert_size < 0         => "invalid_pair"
        insert_size > 1000      => "structural_variant_candidate"
        r1_len < 36 || r2_len < 36 => "short_read"
        insert_size < 150       => "short_insert"
        otherwise               => "normal"
    }
}

given is an expression, so you can assign its result:

let risk = given {
    allele_freq >= 0.5 && coverage >= 30 => "high_confidence_somatic"
    allele_freq >= 0.2                   => "moderate_evidence"
    allele_freq >= 0.05                  => "low_frequency"
    otherwise                            => "below_detection"
}

guard Clauses

guard asserts that a condition is true. If it is not, the else block executes – typically an early return or error.

fn calculate_tmb(variants, exome_size_mb) {
    guard exome_size_mb > 0 else {
        return {error: "Exome size must be positive"}
    }
    guard len(variants) > 0 else {
        return {tmb: 0.0, classification: "low"}
    }

    let somatic = variants |> filter(|v| v.filter == "PASS")
    let tmb = len(somatic) / exome_size_mb

    let classification = given {
        tmb >= 20.0  => "high"
        tmb >= 10.0  => "intermediate"
        otherwise    => "low"
    }

    {tmb: tmb, classification: classification}
}

Guards keep the main logic at the top indentation level by pushing error handling to the margin. Use them liberally for input validation.

unless

unless is syntactic sugar for if !condition. It reads naturally for negative checks.

fn process_bam(path) {
    let header = sam_header(path)

    unless contains(header.sort_order, "coordinate") {
        print("WARNING: BAM is not coordinate-sorted, sorting first")
        shell("samtools sort -o " + path + " " + path)
    }

    unless file_exists(path + ".bai") {
        print("Indexing BAM")
        shell("samtools index " + path)
    }

    # Proceed with analysis
    let stats = flagstat(path)
    stats
}

Example: Classify Variants by Type

Read a VCF and produce a summary table of variant types using match.

let variants = read_vcf("data/variants.vcf")

let classified = variants |> map(|v| {
    let vtype = match true {
        is_snp(v) && is_transition(v)   => "transition"
        is_snp(v) && is_transversion(v) => "transversion"
        is_snp(v)                       => "snp_other"
        is_indel(v) && len(v.alt) > len(v.ref) => "insertion"
        is_indel(v)                     => "deletion"
        _                               => "complex"
    }
    {...v, classification: vtype}
})

let summary = classified
    |> group_by("classification")
    |> map(|group| {type: group.0, count: len(group.1)})
    |> sort(|a, b| b.count - a.count)

for row in summary {
    print(row.type + ": " + str(row.count))
}
# transition: 45231
# transversion: 22890
# deletion: 3412
# insertion: 2876
# complex: 134

Example: Search for Motif with for/else

Scan upstream regions for a transcription-factor binding motif. Report the first hit or state that none was found.

# requires: internet connection
let motif = dna"CANNTG"  # E-box motif (N = any base)
let genes = read_gff("data/annotations.gff")
    |> filter(|f| f.type == "gene" && f.biotype == "protein_coding")

for gene in genes {
    let upstream = interval(gene.chrom, gene.start - 2000, gene.start)
    let seq = ucsc_sequence("hg38", gene.chrom, gene.start - 2000, gene.start)
    let hits = find_motif(seq, motif)

    if len(hits) > 0 {
        print("E-box found upstream of " + gene.name + " at offset " + str(hits[0].position))
        break
    }
} else {
    print("No E-box motif found in any upstream region scanned")
}

Example: Multi-Criteria Sample QC with given/otherwise

Gate samples through a series of quality thresholds and assign a disposition.

fn qc_disposition(stats) {
    given {
        stats.total_reads < 1_000_000 =>
            {pass: false, reason: "insufficient_reads", reads: stats.total_reads}

        stats.pct_mapped < 70.0 =>
            {pass: false, reason: "low_mapping_rate", pct: stats.pct_mapped}

        stats.mean_depth < 10.0 =>
            {pass: false, reason: "low_depth", depth: stats.mean_depth}

        stats.pct_duplicate > 40.0 =>
            {pass: false, reason: "high_duplication", pct: stats.pct_duplicate}

        stats.contamination > 0.03 =>
            {pass: false, reason: "contamination", frac: stats.contamination}

        otherwise =>
            {pass: true, reason: "all_checks_passed"}
    }
}

let samples = ["S001", "S002", "S003", "S004"]
let bam_dir = "data/aligned"

for sample in samples {
    let stats = flagstat(bam_dir + "/" + sample + ".bam")
    let result = qc_disposition(stats)

    if result.pass {
        print(sample + ": PASS")
    } else {
        print(sample + ": FAIL (" + result.reason + ")")
    }
}

Example: Input Validation with guard

A variant-calling wrapper that validates every precondition before running the expensive computation.

fn call_variants(bam_path, ref_path, bed_path, min_depth: 10) {
    guard file_exists(bam_path) else {
        return {error: "BAM file not found: " + bam_path}
    }
    guard file_exists(ref_path) else {
        return {error: "Reference FASTA not found: " + ref_path}
    }
    guard file_exists(bed_path) else {
        return {error: "Target BED not found: " + bed_path}
    }

    let header = sam_header(bam_path)
    guard header.sort_order == "coordinate" else {
        return {error: "BAM must be coordinate-sorted"}
    }
    guard file_exists(bam_path + ".bai") else {
        return {error: "BAM index (.bai) not found"}
    }

    # All preconditions met -- run the caller
    let regions = read_bed(bed_path)
    let vcf_out = "calls.vcf"
    shell("bcftools mpileup -f " + ref_path + " -R " + bed_path + " " + bam_path
        + " | bcftools call -mv -Ov -o " + vcf_out)

    let raw_calls = read_vcf(vcf_out)
    let filtered = raw_calls
        |> filter(|v| v.qual >= 30.0)

    {
        total_calls: len(raw_calls),
        passing_calls: len(filtered),
        variants: filtered
    }
}

Summary

ConstructReturns Value?Best For
if/elseYesBinary or ternary decisions
matchYesMulti-arm pattern dispatch
forNoIteration over collections
for/elseNoSearch with not-found fallback
whileNoIndeterminate iteration
given/otherwiseYesDeclarative condition chains
guard ... elseNoEarly-exit preconditions
unlessNoNegative-condition readability

Choose the construct that best communicates intent. Use guard for validation at function boundaries, given for multi-criteria classification, match for type-driven dispatch, and for/else when a search must report failure.