Functions and Closures
Functions are the primary unit of reuse in BioLang. Whether you are writing a normalisation routine for RNA-seq counts, a scoring function for sequence alignment, or a filter predicate for variant calls, functions let you name a computation and invoke it wherever it is needed.
Defining Functions
A function is introduced with the fn keyword, followed by a name, a
parameter list, and a body enclosed in braces.
fn gc_content(seq) {
let gc = seq |> filter(|b| b == "G" || b == "C") |> len()
gc / seq_len(seq)
}
let ratio = gc_content("ATGCGCTA")
# ratio => 0.5
The last expression in the body is the implicit return value. There is no need
for a return keyword in the common case.
Explicit Return
When you need to exit early – for example after detecting an invalid input –
use return.
fn median_quality(quals) {
if len(quals) == 0 then {
return 0.0
}
let sorted = quals |> sort()
let mid = len(sorted) / 2
if len(sorted) % 2 == 0 then {
(sorted[mid - 1] + sorted[mid]) / 2.0
} else {
sorted[mid]
}
}
Default Parameters
Parameters can carry default values. Callers may omit them.
fn trim_reads(records, min_qual: 20, min_len: 36) {
records
|> filter(|r| mean(r.quality) >= min_qual)
|> filter(|r| seq_len(r.seq) >= min_len)
}
# Use defaults
let trimmed = trim_reads(raw_reads)
# Override quality threshold only
let strict = trim_reads(raw_reads, min_qual: 30)
Default parameters must appear after positional parameters.
Named Return Values
You can declare named return fields to make the return shape explicit.
fn count_variants(vcf_path) -> (snps: Int, indels: Int, other: Int) {
let records = read_vcf(vcf_path)
let snps = 0
let indels = 0
let other = 0
records |> each(|v| {
let vt = variant_type(v)
if vt == "Snp" then snps = snps + 1
else if vt == "Indel" then indels = indels + 1
else other = other + 1
})
}
Closures and Lambdas
A closure is an anonymous function written with pipe delimiters. Short closures
use a single expression; longer ones use { } for a block body.
# Single-expression closure
let is_high_qual = |v| v.qual >= 30.0
# Block closure
let normalise = |counts, size_factors| {
let total = counts |> reduce(0, |a, b| a + b)
counts |> map(|c| (c / total) * 1e6 / size_factors)
}
Closures capture variables from the surrounding scope, which makes them ideal for building specialised predicates on the fly.
fn make_depth_filter(min_depth) {
|record| record.info.DP >= min_depth
}
let deep_enough = make_depth_filter(30)
let filtered = variants |> filter(deep_enough)
Higher-Order Functions
A higher-order function accepts another function (or closure) as an argument, returns one, or both.
fn apply_qc_chain(reads, filters) {
filters |> reduce(reads, |current, f| current |> filter(f))
}
let filters = [
|r| mean(r.quality) >= 20,
|r| seq_len(r.seq) >= 50,
|r| gc_content(r.seq) < 0.8
]
let passing = apply_qc_chain(raw_reads, filters)
Because pipe inserts as the first argument, you can chain higher-order functions fluently:
let top_genes = counts
|> filter(|g| g.biotype == "protein_coding")
|> sort_by(|g| -g.tpm)
|> take(100)
|> map(|g| g.gene_name)
Where Clauses
A where clause attaches a precondition to a function. If the predicate is
false at call time, a runtime error is raised.
fn normalise_counts(counts) where len(counts) > 0 {
let total = counts |> reduce(0, |a, b| a + b)
counts |> map(|c| c / total)
}
fn log2_fold_change(treated, control) where control > 0.0 {
log2(treated / control)
}
fn call_consensus(reads) where len(reads) >= 3 {
let bases = reads |> map(|r| {base: r.base})
let counts = table(bases) |> group_by("base")
|> summarize(|base, group| {base: base, n: len(group)})
counts |> sort_by(|g| -g.n) |> first() |> |g| g.base
}
Where clauses serve as executable documentation: they state the contract and enforce it at the boundary.
The @memoize Decorator
Bioinformatics computations are often called repeatedly with the same inputs –
the same gene queried in an annotation database, the same k-mer scored in a
seed-extension aligner. The @memoize decorator caches results keyed by
argument values.
@memoize
fn gc_of_kmer(kmer) {
gc_content(dna(kmer))
}
# First call computes and caches the result.
# Subsequent calls with the same k-mer return instantly.
let g1 = gc_of_kmer("ATCGGC") # cache miss
let g2 = gc_of_kmer("ATCGGC") # cache hit
Memoization is especially valuable when combined with recursion.
Decorator Notes
@memoize is currently the only built-in decorator. For cross-cutting
concerns like timing or input validation, use wrapper functions or where
clauses.
# Use a wrapper function for timing
fn timed_align(fastq, ref_genome) {
let t0 = now()
let result = align_reads(fastq, ref_genome)
print("Alignment took " + str(now() - t0) + "s")
result
}
# Use where clauses for input validation
fn merge_bams(bam_paths) where len(bam_paths) > 0 {
# ... merge logic ...
}
Recursion
Recursive functions call themselves. BioLang supports standard recursion, which is useful for tree-structured biological data such as phylogenies and ontology DAGs.
fn tree_leaf_count(node) {
if len(node.children) == 0 then {
return 1
}
node.children |> map(tree_leaf_count) |> reduce(0, |a, b| a + b)
}
Combine @memoize with recursion for dynamic-programming-style algorithms:
@memoize
fn needleman_wunsch_score(seq1, seq2, i, j, gap_penalty: -2) {
if i == 0 then { return j * gap_penalty }
if j == 0 then { return i * gap_penalty }
let match_score = if seq1[i - 1] == seq2[j - 1] then 1 else -1
let diag = needleman_wunsch_score(seq1, seq2, i - 1, j - 1) + match_score
let up = needleman_wunsch_score(seq1, seq2, i - 1, j) + gap_penalty
let left = needleman_wunsch_score(seq1, seq2, i, j - 1) + gap_penalty
max(diag, max(up, left))
}
let score = needleman_wunsch_score("AGTACG", "ACATAG", 6, 6)
Example: Memoized K-mer Scoring Function
Counting k-mer matches across many sequences calls the same function millions of times. Caching the GC computation removes redundant work.
@memoize
fn kmer_gc(kmer_str) {
gc_content(dna(kmer_str))
}
fn score_sequence_kmers(seq, k: 21) {
let kmer_list = seq |> kmers(k)
let gc_scores = kmer_list |> map(|km| kmer_gc(to_string(km)))
{
n_kmers: len(gc_scores),
mean_gc: mean(gc_scores),
high_gc_count: gc_scores |> filter(|g| g > 0.6) |> len()
}
}
let result = score_sequence_kmers(dna"ATCGATCGCCCCGGGGATATATATCGCGCGATCG")
print(f"K-mers: {result.n_kmers}, Mean GC: {result.mean_gc:.3f}")
Example: Reusable QC Filter Factory
A factory function returns a closure configured with experiment-specific thresholds. Different sequencing protocols produce different acceptable ranges.
fn make_qc_filter(min_qual: 20, min_len: 50, max_n_frac: 0.05) {
|read| {
let avg_q = mean(read.quality)
let n_frac = (read.seq |> filter(|b| b == "N") |> len()) / seq_len(read.seq)
avg_q >= min_qual && seq_len(read.seq) >= min_len && n_frac <= max_n_frac
}
}
# Whole-genome: permissive
let wgs_filter = make_qc_filter(min_qual: 15, min_len: 36)
# Amplicon: strict
let amp_filter = make_qc_filter(min_qual: 30, min_len: 100, max_n_frac: 0.01)
let wgs_reads = read_fastq("data/reads.fastq") |> filter(wgs_filter)
let amp_reads = read_fastq("data/reads.fastq") |> filter(amp_filter)
print("WGS passing: " + to_string(len(wgs_reads)))
print("Amplicon passing: " + to_string(len(amp_reads)))
Example: Recursive Phylogenetic Tree Traversal
Phylogenetic trees are naturally recursive. This example collects all leaf taxa whose branch length from the root exceeds a threshold – useful for detecting fast-evolving lineages.
fn collect_distant_leaves(node, dist_so_far, threshold) {
let current_dist = dist_so_far + (node.branch_length ?? 0.0)
if len(node.children) == 0 then {
# Leaf node
if current_dist > threshold then {
return [{name: node.name, distance: current_dist}]
} else {
return []
}
}
# Internal node: recurse into children and concatenate results
node.children
|> flat_map(|child| collect_distant_leaves(child, current_dist, threshold))
}
# Build a simple tree as nested records
let tree = {
name: "root", branch_length: 0.0, children: [
{name: "primates", branch_length: 0.08, children: [
{name: "human", branch_length: 0.1, children: []},
{name: "chimp", branch_length: 0.12, children: []}
]},
{name: "rodents", branch_length: 0.20, children: [
{name: "mouse", branch_length: 0.35, children: []},
{name: "rat", branch_length: 0.33, children: []}
]}
]
}
let fast_evolving = collect_distant_leaves(tree, 0.0, 0.30)
fast_evolving |> each(|taxon|
print(taxon.name + " => total branch length " + to_string(taxon.distance))
)
# mouse => total branch length 0.55
# rat => total branch length 0.53
Summary
| Feature | Syntax | Use Case |
|---|---|---|
| Function | fn name(params) { } | Named, reusable computation |
| Default params | fn f(x, k: 10) { } | Flexible call sites |
| Where clause | fn f(x) where x > 0 { } | Precondition contracts |
| Closure | |x| expr | Inline predicates, callbacks |
| Block closure | |x| { stmts } | Multi-step anonymous logic |
| @memoize | @memoize fn f() { } | Cache repeated computations |
| Recursion | Self-call in body | Trees, dynamic programming |
Functions and closures are the building blocks that the rest of BioLang – pipelines, parallel maps, and the standard library – is built upon. Master them and every subsequent chapter becomes easier.