Translation

PTRA — Protein Translation

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

# Rosalind: PTRA — Protein Translation
# https://rosalind.info/problems/ptra/
#
# Given: A DNA string s and a protein string p.
# Return: The genetic code variant table number used for translation.
#
# BioLang uses standard genetic code (table 1). We verify by translating
# and comparing the result.

let dna_seq = dna"ATGGCCATGGCGCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA"
let expected_protein = protein"MAMAPRTEINSTRING"

# translate() stops at the first stop codon
let result = translate(dna_seq)

println("Translated: " + str(result))
println("Expected:   " + str(expected_protein))

# Standard genetic code (table 1) should produce the expected protein
let grid = if result == expected_protein then 1 else 0
println("Table:      " + str(grid))
println("Expected:   1")
println("Match:      " + str(grid == 1))

fn test_ptra_standard_genetic_code() {
    assert grid == 1, "PTRA: standard code (grid 1) should reproduce " + str(expected_protein)
}