Translation

BA4A — Translate an RNA String into an Amino Acid String

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

# Rosalind: BA4A — Translate an RNA String into an Amino Acid String
# https://rosalind.info/problems/ba4a/
#
# Given: An RNA string Pattern.
# Return: The translation of Pattern into an amino acid string.

let pattern = rna"AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"

let result = str(translate(pattern))

println("Result:   " + result)
println("Expected: MAMAPRTEINSTRING")

fn test_ba4a_translation() {
    assert result == "MAMAPRTEINSTRING", "BA4A: got " + result
}

BA4B — Find Substrings of a Genome Encoding a Given Amino Acid String

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

A peptide can be encoded on either strand, so both are searched. ATGGCC appears twice and both occurrences count — the answer is substrings by position, not a set of distinct strings.

# Rosalind: BA4B — Find Substrings of a Genome Encoding a Given Amino Acid String
# https://rosalind.info/problems/ba4b/
#
# Given: A DNA string Text and an amino acid string Peptide.
# Return: All substrings of Text encoding Peptide.

let text = "ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA"
let peptide = "MA"

# A peptide can be encoded on either strand, so both have to be searched. The
# reverse strand is read in the opposite direction, which is why the reverse
# complement is translated rather than the original read backwards.
let width = len(peptide) * 3

fn encodes(candidate, wanted) {
    let forward = str(translate(dna(candidate)))
    let backward = str(translate(reverse_complement(dna(candidate))))
    forward == wanted or backward == wanted
}

let found = range(0, len(text) - width + 1)
    |> map(|i| substr(text, i, width))
    |> filter(|candidate| encodes(candidate, peptide))

println("Result:")
for candidate in found { println("  " + candidate) }
println("Expected: ATGGCC GGCCAT ATGGCC")

fn test_ba4b_peptide_encoding() {
    assert join(found, " ") == "ATGGCC GGCCAT ATGGCC", "BA4B: got " + join(found, " ")
    # ATGGCC appears twice, and both occurrences count — the answer is a list of
    # substrings by position, not a set of distinct strings.
    assert len(found) == 3, "BA4B: expected 3 substrings"
    assert len(unique(found)) == 2, "BA4B: two of them are the same string"
    # GGCCAT is the one found on the reverse strand.
    assert str(translate(reverse_complement(dna("GGCCAT")))) == peptide,
        "BA4B: GGCCAT should encode MA on the reverse strand"
}