Motifs

5 problems from Rosalind — Bioinformatics Textbook Track. Press Run on any block to execute it in your browser.

BA2C — Find a Profile-most Probable k-mer

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

The product down the profile's columns. Every entry here is non-zero so no window is ruled out, which is the situation pseudocounts exist to fix in the problems that follow.

# Rosalind: BA2C — Find a Profile-most Probable k-mer in a String
# https://rosalind.info/problems/ba2c/
#
# Given: A string Text, an integer k, and a 4 x k matrix Profile.
# Return: A Profile-most probable k-mer in Text.

let text = "ACCTGTTTATTGCCTAAGTTCCGAACAAACCCAATATAGCCCGAGGGCCT"
let k = 5

# Rows are A, C, G, T; columns are the positions of the k-mer.
let profile = [
    [0.2, 0.2, 0.3, 0.2, 0.3],
    [0.4, 0.3, 0.1, 0.5, 0.1],
    [0.3, 0.3, 0.5, 0.2, 0.4],
    [0.1, 0.2, 0.1, 0.1, 0.2],
]

fn row_of(symbol) {
    if symbol == "A" then 0
    else if symbol == "C" then 1
    else if symbol == "G" then 2
    else 3
}

# A k-mer's probability is the product down its columns. Every entry here is
# non-zero, so no window is ruled out; a profile with a zero would silently
# eliminate one, which is why pseudocounts exist in the problems that follow.
fn probability(kmer) {
    range(0, len(kmer))
      |> reduce(|acc, i| acc * profile[row_of(substr(kmer, i, 1))][i], 1.0)
}

let kmer_windows = range(0, len(text) - k + 1) |> map(|i| substr(text, i, k))
let scores = kmer_windows |> map(|w| probability(w))
let best = kmer_windows[argmax(scores)]

println("Result:   " + best)
println("Expected: CCGAG")

fn test_ba2c_profile_most_probable() {
    assert best == "CCGAG", "BA2C: got " + best
    assert probability(best) == max(scores), "BA2C: the reported k-mer is not the most probable"
}

BA2D — Implement GreedyMotifSearch

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Greedy in the strict sense: each string picks what the current profile likes best and nothing is reconsidered. Fast, and wrong often enough that BA2E exists.

# Rosalind: BA2D — Implement GreedyMotifSearch
# https://rosalind.info/problems/ba2d/
#
# Given: Integers k and t, followed by a collection of strings Dna.
# Return: A collection BestMotifs resulting from GreedyMotifSearch(Dna, k, t).
# Where several profile-most probable k-mers tie, take the first.

let k = 3
let t = 5
let sequences = [
    "GGCGTTCAGGCA",
    "AAGAATCAGTCA",
    "CAAGGAGTTCGC",
    "CACGTCAATCAC",
    "CAATAATATTCG",
]

# Greedy in the strict sense: try every k-mer of the first string as a seed, then
# let each later string pick whatever its current profile likes best, never
# reconsidering. Fast, and wrong often enough that BA2E exists to fix it.
fn greedy_motifs(strings, width, pseudocount) {
    let best = strings |> map(|s| substr(s, 0, width))
    let first = strings[0]
    for start in range(0, len(first) - width + 1) {
        let motifs = [substr(first, start, width)]
        for i in range(1, len(strings)) {
            let profile = motif_profile(motifs, pseudocount)
            motifs = push(motifs, profile_most_probable(strings[i], width, profile))
        }
        if motif_score(motifs) < motif_score(best) {
            best = motifs
        }
    }
    best
}

let best_motifs = greedy_motifs(sequences, k, 0)

println("Result:")
for motif in best_motifs { println("  " + motif) }
println("Expected: CAG CAG CAA CAA CAA")

fn test_ba2d_greedy_motif_search() {
    assert join(best_motifs, " ") == "CAG CAG CAA CAA CAA",
        "BA2D: got " + join(best_motifs, " ")
    assert len(best_motifs) == t, "BA2D: one motif per string"
    # Every motif has to actually occur in its own string.
    for i in range(0, len(sequences)) {
        assert contains(sequences[i], best_motifs[i]),
            "BA2D: " + best_motifs[i] + " is not in " + sequences[i]
    }
}

BA2E — Implement GreedyMotifSearch with Pseudocounts

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

One number different from BA2D. Without a pseudocount a base absent from a column makes every k-mer containing it impossible rather than unlikely. On this five-string sample the two versions actually tie at a score of 2 — the assertion says so rather than claiming an improvement the data does not show.

# Rosalind: BA2E — Implement GreedyMotifSearch with Pseudocounts
# https://rosalind.info/problems/ba2e/
#
# Given: Integers k and t, followed by a collection of strings Dna.
# Return: BestMotifs from GreedyMotifSearch(Dna, k, t) with pseudocounts.

let k = 3
let t = 5
let sequences = [
    "GGCGTTCAGGCA",
    "AAGAATCAGTCA",
    "CAAGGAGTTCGC",
    "CACGTCAATCAC",
    "CAATAATATTCG",
]

# The same greedy loop as BA2D, changing one number. Without a pseudocount a base
# absent from a column has probability zero, so any k-mer containing it is
# impossible rather than merely unlikely — one unlucky column silently discards
# every candidate, and the search follows whichever k-mer happened to come first.
# Laplace's rule of succession fixes it by adding one to every count.
fn greedy_motifs_smoothed(strings, width, pseudocount) {
    let best = strings |> map(|s| substr(s, 0, width))
    let first = strings[0]
    for start in range(0, len(first) - width + 1) {
        let motifs = [substr(first, start, width)]
        for i in range(1, len(strings)) {
            let profile = motif_profile(motifs, pseudocount)
            motifs = push(motifs, profile_most_probable(strings[i], width, profile))
        }
        if motif_score(motifs) < motif_score(best) {
            best = motifs
        }
    }
    best
}

let best_motifs = greedy_motifs_smoothed(sequences, k, 1)

println("Result:")
for motif in best_motifs { println("  " + motif) }
println("Expected: TTC ATC TTC ATC TTC")

fn test_ba2e_greedy_motif_search_with_pseudocounts() {
    assert join(best_motifs, " ") == "TTC ATC TTC ATC TTC",
        "BA2E: got " + join(best_motifs, " ")
    for i in range(0, len(sequences)) {
        assert contains(sequences[i], best_motifs[i]),
            "BA2E: " + best_motifs[i] + " is not in " + sequences[i]
    }
    # Worth being exact about: on this five-string sample the smoothed answer
    # does *not* beat BA2D's, it ties with it — both disagree in two places. The
    # pseudocount changes which motifs are found, and pays off on inputs large
    # enough for a zero to wipe out a good candidate; a toy sample does not show
    # that, and claiming otherwise here would be checking a wish.
    let without_pseudocounts = ["CAG", "CAG", "CAA", "CAA", "CAA"]
    assert motif_score(best_motifs) == 2, "BA2E: expected a score of 2"
    assert motif_score(without_pseudocounts) == 2, "BA2D's answer also scores 2"
    assert join(best_motifs, " ") != join(without_pseudocounts, " "),
        "BA2E: the pseudocount should at least change which motifs are chosen"
}

BA2F — Implement RandomizedMotifSearch

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Seeded so the example is reproducible. Graded on the score reached rather than on one particular set, because several distinct sets tie at the optimum of 9 — asserting on the published one would be asserting on the seed.

# Rosalind: BA2F — Implement RandomizedMotifSearch
# https://rosalind.info/problems/ba2f/
#
# Given: Integers k and t, followed by a collection of strings Dna.
# Return: The best motifs found over 1000 runs of RandomizedMotifSearch.

let k = 8
let t = 5
let sequences = [
    "CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA",
    "GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG",
    "TAGTACCGAGACCGAAAGAAGTATACAGGCGT",
    "TAGATCAAGTTTCAGGTGCACGTCGGTGAACC",
    "AATCCACCAGCTCCACGTGCAATGTTGGCCTA",
]

# Seeded, so this example gives the same answer every time it is run. The
# algorithm is genuinely random; only the reporting is pinned.
set_seed(20260803)

# Start from k-mers chosen at random, then repeatedly rebuild the profile and let
# every string re-pick against it. Each round can only lower the score, so it
# stops as soon as one does not — a local optimum, and usually a poor one, which
# is why the whole thing is thrown away and restarted a thousand times.
fn one_random_run(strings, width) {
    let motifs = strings |> map(|s| {
        let start = random_int(0, len(s) - width + 1)
        substr(s, start, width)
    })
    let best = motifs
    let improving = true
    while improving {
        let profile = motif_profile(motifs, 1)
        motifs = strings |> map(|s| profile_most_probable(s, width, profile))
        if motif_score(motifs) < motif_score(best) {
            best = motifs
        } else {
            improving = false
        }
    }
    best
}

let best_motifs = one_random_run(sequences, k)
for _ in range(1, 1000) {
    let attempt = one_random_run(sequences, k)
    if motif_score(attempt) < motif_score(best_motifs) {
        best_motifs = attempt
    }
}

println("Result:")
for motif in best_motifs { println("  " + motif) }
println("Score: " + str(motif_score(best_motifs)))
println("Expected (one optimal answer): TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG")
println("which also scores 9 — several distinct motif sets tie at the optimum here")

fn test_ba2f_randomized_motif_search() {
    # A randomized search is graded on the score it reaches, not on returning one
    # particular set — several sets tie at the optimum, and asserting on the
    # published one would be asserting on this seed.
    let published = ["TCTCGGGG", "CCAAGGTG", "TACAGGCG", "TTCAGGTG", "TCCACGTG"]
    assert motif_score(best_motifs) <= motif_score(published),
        "BA2F: scored " + str(motif_score(best_motifs))
            + " against the published " + str(motif_score(published))
    assert len(best_motifs) == t, "BA2F: one motif per string"
    for i in range(0, len(sequences)) {
        assert contains(sequences[i], best_motifs[i]),
            "BA2F: " + best_motifs[i] + " is not in string " + str(i)
        assert len(best_motifs[i]) == k, "BA2F: every motif is k long"
    }
}

BA2G — Implement GibbsSampler

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Replaces one motif at a time rather than all of them, and draws in proportion to probability instead of taking the best — which is what lets it leave a local optimum. Rosalind's suggested 20 starts settles at 10 here; 200 reaches the optimal 9.

# Rosalind: BA2G — Implement GibbsSampler
# https://rosalind.info/problems/ba2g/
#
# Given: Integers k, t and N, followed by a collection of strings Dna.
# Return: The best motifs found over 20 random starts of GibbsSampler.

let k = 8
let t = 5
let iterations = 100
let sequences = [
    "CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA",
    "GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG",
    "TAGTACCGAGACCGAAAGAAGTATACAGGCGT",
    "TAGATCAAGTTTCAGGTGCACGTCGGTGAACC",
    "AATCCACCAGCTCCACGTGCAATGTTGGCCTA",
]

set_seed(20260803)

fn all_except(items, index) {
    range(0, len(items)) |> filter(|i| i != index) |> map(|i| items[i])
}

# Not the most probable k-mer, but one drawn in proportion to its probability.
# That is the whole difference from BA2F: always taking the best makes the search
# unable to leave a local optimum, whereas sometimes taking a worse k-mer lets it
# climb back out.
fn profile_random_kmer(text, width, profile) {
    let weights = range(0, len(text) - width + 1)
        |> map(|start| profile_probability(substr(text, start, width), profile))
    let total = sum(weights)
    let target = random() * total
    let running = 0.0
    let chosen = len(weights) - 1
    for i in range(0, len(weights)) {
        running = running + weights[i]
        if running >= target and chosen == len(weights) - 1 and i < len(weights) - 1 {
            chosen = i
        }
    }
    substr(text, chosen, width)
}

# Where RandomizedMotifSearch replaces every motif at once, Gibbs replaces one at
# a time and leaves the rest standing. Changing less per step is what lets it
# keep a good partial answer instead of discarding it wholesale.
fn one_gibbs_run(strings, width, rounds) {
    let motifs = strings |> map(|s| {
        let start = random_int(0, len(s) - width + 1)
        substr(s, start, width)
    })
    let best = motifs
    for _ in range(0, rounds) {
        let i = random_int(0, len(strings))
        let profile = motif_profile(all_except(motifs, i), 1)
        motifs[i] = profile_random_kmer(strings[i], width, profile)
        if motif_score(motifs) < motif_score(best) {
            best = motifs
        }
    }
    best
}

# Rosalind suggests 20 random starts. That is a floor, not a guarantee: with 20
# this sample settles at a score of 10 rather than the optimal 9, because Gibbs
# changes one motif at a time and a bad start takes many rounds to escape. More
# starts is the knob that fixes it, and 200 finds the optimum here.
let best_motifs = one_gibbs_run(sequences, k, iterations)
for _ in range(1, 200) {
    let attempt = one_gibbs_run(sequences, k, iterations)
    if motif_score(attempt) < motif_score(best_motifs) {
        best_motifs = attempt
    }
}

println("Result:")
for motif in best_motifs { println("  " + motif) }
println("Score: " + str(motif_score(best_motifs)))
println("Expected (one optimal answer): TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG, score 9")

fn test_ba2g_gibbs_sampler() {
    # Graded on the score reached, not on one particular set — as in BA2F,
    # several sets can tie. With the seed pinned above this run happens to
    # recover the published motifs exactly, which the output shows.
    let published = ["TCTCGGGG", "CCAAGGTG", "TACAGGCG", "TTCAGGTG", "TCCACGTG"]
    assert motif_score(best_motifs) <= motif_score(published),
        "BA2G: scored " + str(motif_score(best_motifs))
            + " against the published " + str(motif_score(published))
    assert len(best_motifs) == t, "BA2G: one motif per string"
    for i in range(0, len(sequences)) {
        assert contains(sequences[i], best_motifs[i]),
            "BA2G: " + best_motifs[i] + " is not in string " + str(i)
        assert len(best_motifs[i]) == k, "BA2G: every motif is k long"
    }
}