# Rosalind: INI — Introduction to the Bioinformatics Armory
# https://rosalind.info/problems/ini/
#
# Given: A DNA string s of length at most 1000 bp.
# Return: Four integers separated by spaces counting A, C, G, T occurrences.

let s = dna"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

let counts = base_counts(s)
let result = str(counts.A) + " " + str(counts.C) + " " + str(counts.G) + " " + str(counts.T)

println("Result:   " + result)
println("Expected: 20 12 17 21")
println("Match:    " + str(result == "20 12 17 21"))

fn test_ini_base_counts() {
    assert result == "20 12 17 21", "INI: expected '20 12 17 21', got '" + result + "'"
}