Sequence

10 problems from Rosalind — Bioinformatics Stronghold. Press Run on any block to execute it in your browser.

DNA — Counting DNA Nucleotides

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

A warm-up for the site's input format rather than a biological question — but the four counts it produces are exactly what GC content is computed from, and a lopsided base composition is the first thing a QC tool flags as contamination or adapter read-through.

# Rosalind: DNA — Counting DNA Nucleotides
# https://rosalind.info/problems/dna/
#
# Given: A DNA string s of length at most 1000 nt.
# Return: Four integers counting A, C, G, T.

let s = dna"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

let counts = base_counts(s)
let result = str(counts.A) + " " + str(counts.C) + " " + str(counts.G) + " " + str(counts.T)

println("Result:   " + result)
println("Expected: 20 12 17 21")

fn test_dna_nucleotide_counts() {
    assert result == "20 12 17 21", "DNA: got '" + result + "'"
}

RNA — Transcribing DNA into RNA

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

One character substituted for another, which is a fair summary of transcription only if you ignore splicing, capping and polyadenylation. SPLC covers the part this leaves out.

# Rosalind: RNA — Transcribing DNA into RNA
# https://rosalind.info/problems/rna/
#
# Given: A DNA string t.
# Return: The RNA string u, with every T replaced by U.

let t = dna"GATGGAACTTGACTACGTAAATT"
let u = transcribe(t)

println("Result:   " ++ str(u))
println("Expected: GAUGGAACUUGACUACGUAAAUU")

fn test_rna_transcription() {
    assert str(u) == "GAUGGAACUUGACUACGUAAAUU", "RNA: got " ++ str(u)
}

REVC — Complementing a Strand of DNA

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

The most-used operation in the whole track. A read carries no record of which strand it came from, so a motif present on one strand appears as its reverse complement on the other — which is why REVP, BA6E and GASM all have to search both.

# Rosalind: REVC — Complementing a Strand of DNA
# https://rosalind.info/problems/revc/
#
# Given: A DNA string s of length at most 1000 bp.
# Return: The reverse complement of s.

let s = dna"AAAACCCGGT"
let rc = reverse_complement(s)

println("Result:   " ++ str(rc))
println("Expected: ACCGGGTTTT")

fn test_revc_reverse_complement() {
    assert str(rc) == "ACCGGGTTTT", "REVC: got " ++ str(rc)
}

HAMM — Counting Point Mutations

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Counts differing positions, which undercounts mutations: a site can change and change back, leaving no trace. RSUB shows exactly that happening, and it is why distance models correct for unseen substitutions rather than using raw counts.

# Rosalind: HAMM — Counting Point Mutations
# https://rosalind.info/problems/hamm/
#
# Given: Two DNA strings s and t of equal length.
# Return: The Hamming distance between them.

let s = dna"GAGCCTACTAACGGGAT"
let t = dna"CATCGTAATGACGGCCT"

let distance = hamming_distance(s, t)

println("Result:   " + str(distance))
println("Expected: 7")

fn test_hamm_point_mutations() {
    assert distance == 7, "HAMM: got " + str(distance)
}

GC — Computing GC Content

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

GC content ranges from about 16 to 75 percent across bacteria, and a difference under 5 percent is taken as evidence of the same species — which is why a fragment's GC content alone narrows down where it came from. It also biases sequencing: GC-rich regions amplify poorly and end up under-covered.

# Rosalind: GC — Computing GC Content
# https://rosalind.info/problems/gc/
#
# Given: At most 10 DNA strings in FASTA format.
# Return: The ID of the string with the highest GC content, and that content.

let records = [
    { id: "Rosalind_6404", seq: dna"CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG" },
    { id: "Rosalind_5959", seq: dna"CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC" },
    { id: "Rosalind_0808", seq: dna"CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT" }
]

let scored = records |> map(|r| { id: r.id, gc: gc_content(r.seq) * 100.0 })
let best = scored |> sort_by(|r| r.gc) |> reverse() |> first()

println("Result:   " + best.id + " " + str(best.gc))
println("Expected: Rosalind_0808 60.919540")

fn test_gc_highest_content() {
    assert best.id == "Rosalind_0808", "GC: picked " + best.id
    assert round(best.gc, 6) == 60.91954, "GC: got " + str(best.gc)
}

TRAN — Transitions and Transversions

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

A random mutation process would give a ratio near 0.5, since there are twice as many ways to make a transversion. Real human data sits near 2.1 genome-wide and near 3 in exomes, largely because methylated cytosine deaminates to thymine. The ratio is therefore a standard quality check: a callset far from those values is reporting sequencing error rather than biology.

# Rosalind: TRAN — Transitions and Transversions
# https://rosalind.info/problems/tran/
#
# Given: Two DNA strings of equal length.
# Return: The transition/transversion ratio.

let s1 = "GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT"
let s2 = "TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGCGGTACGAGTGTTCCTTTGGGT"

# A transition swaps purine for purine (A<->G) or pyrimidine for pyrimidine
# (C<->T); anything else is a transversion.
fn is_purine(base) { base == "A" or base == "G" }

fn is_transition(a, b) { is_purine(a) == is_purine(b) }

let differing = range(0, len(s1)) |> filter(|i| substr(s1, i, 1) != substr(s2, i, 1))
let transitions = differing |> count_if(|i| is_transition(substr(s1, i, 1), substr(s2, i, 1)))
let transversions = len(differing) - transitions

let ratio = float(transitions) / float(transversions)

println("Result:   " + str(ratio))
println("Expected: 1.21428571429")

fn test_tran_ratio() {
    assert round(ratio, 8) == 1.21428571, "TRAN: got " + str(ratio)
}

CONS — Consensus and Profile

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

A profile is the same object BA2's motif search builds and scores against: counts per base per position. The consensus reads off the commonest base at each, which is a useful summary and a lossy one — it discards how strong the preference was.

# Rosalind: CONS — Consensus and Profile
# https://rosalind.info/problems/cons/
#
# Given: A collection of DNA strings of equal length in FASTA format.
# Return: A consensus string, and the profile matrix of base counts per column.

let strings = [
    "ATCCAGCT", "GGGCAACT", "ATGGATCT", "AAGCAACC",
    "TTGGAACT", "ATGCCATT", "ATGGCACT"
]

let bases = ["A", "C", "G", "T"]
# Held as plain strings: str() on a DNA value renders as "DNA(...)", so substr
# would slice the wrapper rather than the sequence.
let width = len(strings[0])

# profile[base][column] — how often each base appears at each position.
let profile = bases |> map(|b| {
    range(0, width) |> map(|i| strings |> count_if(|s| substr(s, i, 1) == b))
})

# The consensus takes whichever base is commonest in each column.
let consensus_string = range(0, width)
    |> map(|i| {
        let column = range(0, 4) |> map(|b| { base: bases[b], n: profile[b][i] })
        let best = column |> sort_by(|e| e.n) |> reverse() |> first()
        best.base
    })
    |> join("")

println("Result:   " + consensus_string)
println("Expected: ATGCAACT")
range(0, 4) |> each(|b| println("  " + bases[b] + ": " + (profile[b] |> map(|n| str(n)) |> join(" "))))

fn test_cons_consensus_and_profile() {
    assert consensus_string == "ATGCAACT", "CONS: got " + consensus_string
    assert profile[0][0] == 5, "CONS: A count at column 1 was " + str(profile[0][0])
    assert profile[3][0] == 1, "CONS: T count at column 1 was " + str(profile[3][0])
}

REVP — Locating Restriction Sites

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Restriction enzymes cut at reverse palindromes because they bind as symmetric dimers, one subunit per strand, so the site reads the same on both. That is why these particular sequences matter and why they are always even in length.

# Rosalind: REVP — Locating Restriction Sites
# https://rosalind.info/problems/revp/
#
# Given: A DNA string of length at most 1 kbp.
# Return: The position and length of every reverse palindrome of length
# between 4 and 12, as 1-based positions.

let s = "TCAATGCATGCGGGTCTATATGCAT"

# A reverse palindrome reads the same as its own reverse complement, so a
# window qualifies when it equals reverse_complement(window).
fn is_reverse_palindrome(window) {
    str(reverse_complement(dna(window))) == window
}

let found = range(4, 13) |> flat_map(|width| {
    range(0, len(s) - width + 1)
        |> filter(|i| is_reverse_palindrome(substr(s, i, width)))
        |> map(|i| { position: i + 1, length: width })
}) |> sort_by(|hit| hit.position)

println("Result:   " + str(len(found)) + " palindromes")
found |> each(|hit| println("  " + str(hit.position) + " " + str(hit.length)))
println("Expected: 8 — (4,6) (5,4) (6,6) (7,4) (17,4) (18,4) (20,6) (21,4)")

fn test_revp_reverse_palindromes() {
    assert len(found) == 8, "REVP: got " + str(len(found))
    assert found[0].position == 4 and found[0].length == 6, "REVP: first was " + str(found[0])
}

CORR — Error Correction in Reads

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

Assumes a correct read appears at least twice and an erroneous one exactly once — which is what read depth buys and why coverage matters. Reverse complements count as the same read, since strand is not recorded.

# Rosalind: CORR — Error Correction in Reads
# https://rosalind.info/problems/corr/
#
# Given: A collection of reads of equal length. Each read either appears in the
# dataset at least twice (counting reverse complements), or is a single-symbol
# error away from exactly one such read.
# Return: Every correction, as "wrong->right".

let reads = ["TCATC", "TTCAT", "TCATC", "TGAAA", "GAGGA", "TTTCA", "ATCAA", "TTGAT", "TTTCC"]

fn revcomp(read) { str(reverse_complement(dna(read))) }

fn hamming_of(a, b) {
    range(0, len(a)) |> count_if(|i| substr(a, i, 1) != substr(b, i, 1))
}

# A read is correct when it, plus its reverse complement, appears at least
# twice across the dataset.
fn occurrences(read) {
    let direct = reads |> count_if(|r| r == read)
    let reversed = reads |> count_if(|r| r == revcomp(read))
    direct + reversed
}

let correct = reads |> filter(|r| occurrences(r) >= 2) |> unique()
let wrong = reads |> filter(|r| occurrences(r) < 2) |> unique()

# Each incorrect read is one substitution from exactly one correct read, in
# either orientation.
let corrections = wrong |> map(|bad| {
    let targets = correct |> flat_map(|good| [good, revcomp(good)])
    let repaired = targets |> filter(|t| hamming_of(bad, t) == 1) |> first()
    bad ++ "->" ++ repaired
})

println("Result:")
corrections |> each(|c| println("  " + c))
println("Expected: TTCAT->TTGAT, GAGGA->GATGA, TTTCC->TTTCA")

fn test_corr_error_correction() {
    assert len(corrections) == 3, "CORR: got " + str(len(corrections))
    assert corrections |> contains("TTCAT->TTGAT"), "CORR: missing TTCAT->TTGAT"
    assert corrections |> contains("GAGGA->GATGA"), "CORR: missing GAGGA->GATGA"
    assert corrections |> contains("TTTCC->TTTCA"), "CORR: missing TTTCC->TTTCA"
}

KMER — k-Mer Composition

solvedbrowser + CLI Problem statement Open in the workbench Download .bl

The official answer is a 256-entry array. Rather than restate it, the assertion checks the ordering endpoints, that the counts total the number of windows, and cross-checks an entry by independent counting — which is what an ordering or lookup mistake would break.

# Rosalind: KMER - k-Mer Composition
# https://rosalind.info/problems/kmer/
#
# Given: A DNA string s.
# Return: The 4-mer composition of s: the count of every one of the 256
# possible 4-mers, in lexicographic order.
#
# This uses the sample dataset published with the problem, and asserts the
# published answer. It previously used a different 768-character sequence that
# shared only its first 25 characters with the official one, so the printed
# result could not match and the assertions only checked the shape of the
# output - 256 entries, counts summing to the window count - rather than
# whether the answer was right.

let s = "CTTCGAAAGTTTGGGCCGAGTCTTACAGTCGGTCTTGAAGCAAAGTAACGAACTCCACGG"
    ++ "CCCTGACTACCGAACCAGTTGTGAGTACTCAACTGGGTGAGAGTGCAGTCCCTATTGAGT"
    ++ "TTCCGAGACTCACCGGGATTTTCGATCCAGCCTCAGTCCAGTCTTGTGGCCAACTCACCA"
    ++ "AATGACGTTGGAATATCCCTGTCTAGCTCACGCAGTACTTAGTAAGAGGTCGCTGCAGCG"
    ++ "GGGCAAGGAGATCGGAAAATGTGCTCTATATGCGACTAAAGCTCCTAACTTACACGTAGA"
    ++ "CTTGCCCGTGTTAAAAACTCGGCTCACATGCTGTCTGCGGCTGGCTGTATACAGTATCTA"
    ++ "CCTAATACCCTTCAGTTCGCCGCACAAAAGCTGGGAGTTACCGCGGAAATCACAG"
let k = 4

let alphabet = ["A", "C", "G", "T"]

# Every 4-mer in lexicographic order, so the counts line up with the ordering
# the problem asks for.
let all_kmers = range(0, k) |> reduce(
    |acc, _| acc |> flat_map(|prefix| alphabet |> map(|b| prefix ++ b)),
    [""]
)

# Count the windows of s once, then look each k-mer up.
let window_list = range(0, len(s) - k + 1) |> map(|i| substr(s, i, k))
let counts = all_kmers |> map(|kmer| window_list |> count_if(|w| w == kmer))

let expected = split("4 1 4 3 0 1 1 5 1 3 1 2 2 1 2 0 1 1 3 1 2 1 3 1 1 1 1 2 2 5 1 3 0 2 "
    ++ "2 1 1 1 1 3 1 0 0 1 5 5 1 5 0 2 0 2 1 2 1 1 1 2 0 1 0 0 1 1 3 2 1 0 "
    ++ "3 2 3 0 0 2 0 8 0 0 1 0 2 1 3 0 0 0 1 4 3 2 1 1 3 1 2 1 3 1 2 1 2 1 "
    ++ "1 1 2 3 2 1 1 0 1 1 3 2 1 2 6 2 1 1 1 2 3 3 3 2 3 0 3 2 1 1 0 0 1 4 "
    ++ "3 0 1 5 0 2 0 1 2 1 3 0 1 2 2 1 1 0 3 0 0 4 5 0 3 0 2 1 1 3 0 3 2 2 "
    ++ "1 1 0 2 1 0 2 2 1 2 0 2 2 5 2 2 1 1 2 1 2 2 2 2 1 1 3 4 0 2 1 1 0 1 "
    ++ "2 2 1 1 1 5 2 0 3 2 1 1 2 2 3 0 3 0 1 3 1 2 3 0 2 1 2 2 1 2 3 0 1 2 "
    ++ "3 1 1 3 1 0 1 1 3 0 2 1 2 2 0 2 1 1", " ") |> map(|x| int(x))

println("Result:   " + (take(counts, 12) |> map(|c| str(c)) |> join(" ")) + " ...")
println("Expected: " + (take(expected, 12) |> map(|c| str(c)) |> join(" ")) + " ...")

fn test_kmer_composition() {
    assert len(counts) == 256, "KMER: got " + str(len(counts)) + " entries"
    assert all_kmers[0] == "AAAA", "KMER: order starts at " + all_kmers[0]
    assert all_kmers[255] == "TTTT", "KMER: order ends at " + all_kmers[255]
    # The published answer, entry by entry.
    assert counts == expected, "KMER: composition does not match the published answer"
    # Every window is counted exactly once.
    assert sum(counts) == len(s) - k + 1, "KMER: counts total " + str(sum(counts))
}